Posted: September 13th, 2017

Bio-informatic (Recombinant Protein)

Paper, Order, or Assignment Requirements

 

 

i will upload files contain everything you need and please read through and you must fallow the Specific assessment criteria for the Practical Report . also the are some references you should use them , if you have any question about the calculation or anything please let me know .

Specific assessment criteria for the Practical Report

The word count should be given at the end of every section (10 % of the marks will be deducted if the word count is not given).

Reference should be made to journals such as Microbiology and the Biochemical Journal for examples of the style in which the series experiments such be written up.

Each section should be autonomous, ie. should be self-contained and understandable without reference to other sections.

The Title should be no more than 10 words. It should be as short as possible but it must be descriptive. (5 marks)

The Abstract should be no more than 40 words. It is much easier to write this section last. It should briefly describe the results obtained and any conclusions made (10 marks)

The Introduction should be no more than 200 words (± 10 %). You should start with a survey of the relevant literature, eg. otherhyaluronidases, and finish with the objective of the series of experiments performed (25 marks)

Materials and Methods not required

The Results section should be no more than 200 words (± 10 %). It should present all results obtained during the series of experiments. Diagrams, tables, photographs and calculations should be presented if appropriate. No discussion of results should be given and it should be broken into sub-sections (25 marks)

The Discussion should be no more than 200 words (± 10 %). It should contain a brief summary of results obtained and whether the objective stated in the Intro was achieved. It should also contain a detail discussion of the results and any conclusions which can be drawn from the results (30 marks)

The References section should contain a list of references cited in the report (5 marks)

Journal articles should should be formatted as follows:

in text

 (Black, 1998)

 (Black and White, 1998)

 (Black et al., 1998)

 

in reference section

 Black GW (1998) Xylanases from bacteria.Biochemical Journal 10, 12-35.

 Black GW and White AB (1998) Xylanases from bacteria.Biochemical Journal 10, 12-35.

24

 

 Black GW, White AB and Red CD (1998) Xylanases from bacteria.Biochemical Journal 10, 12-35.

 

Book chapters should be formatted as follows:

in text

 (Black and White, 1997)



 

in reference section

 Black GW and White AB (1997) Xylanases from bacteria.In Xylan and xylanasesed. Blue FG pp. 2-40, Academic Press., London UK.

 

 

 

 

Introduction

N Nis a Gram-positive, nonmotile, nonsporeforming coccus N Ntypically have a capsule composed of hyaluronic acid and exhibit beta (clear) hemolysis on blood agar (Figure 1).

Figure 1. Colonies of N Non blood agar exhibiting beta (clear) hemolysis

 

Acute N Ninfections may present as pharyngitis (strep throat), scarlet fever (rash), impetigo (infection of the superficial layers of the skin) or cellulitis (infection of the deep layers of the skin). Invasive, toxigenic infections can result in necrotizing fasciitis (flesh-eating disease), myositis (muscle swelling) and streptococcal toxic shock syndrome

.

N Nproduces a wide array of virulence factors and a very large number of diseases. Virulence factors include:

(1) M protein, fibronectin-binding protein (Protein F) and lipoteichoic acid for adherence;

(2) hyaluronic acid capsule as an immunological disguise and to inhibit phagocytosis; M-protein to inhibit phagocytosis;

(3) invasins such as streptokinase, streptodornase (DNase B), hyaluronidase, and streptolysins; and

(4) exotoxins, such as pyrogenic (erythrogenic) toxin which causes the rash of scarlet fever and systemic toxic shock syndrome

 

The sequence of the N Ngenome has recently been completed but is not published yet. The protein encoded by one particular ORF, HylP1, was identified, by sequence similarity, as a putative hyaluronidase (see protein sequence in Appendix).

The objectives of this series of experiments are to amplify ORF HylP1 from the N Ngenome using PCR, clone the amplified product into expression vector pET22b, and express, purify and biochemically characterise the recombinant protein.

LAB PRACTICAL 1: Isolation of genomic DNA from N NSafety

1) Microcentrifugesrotate at very high speeds. Always ensure that tubes are positioned in a balanced configuration and that all lids (inner covers are provided for some instruments) are tightly closed.

 

Genomic DNA will be isolated from N Nusing a modified salt precipitation method of the GentraPuregene DNA Purification Kit (Qiagen) for Gram-positive bacteria.

Methods

N.B. Centrifugation was always performed at top speed (14000 x g).

Initial your tubes throughout these methods as you will be spinning your tubes with other students.

1. Centrifuge microcentrifuge tube containing 0.5 ml of N Nculture for 1 min. Pour off supernatant into discard pots provided. Pulse (centrifuge for 5 sec) microcentrifuge tube and remove residual supernatant with a micropipette.
2. Add 300 l of cell suspension solution to cell pellet and gently pipette up and down until cells are suspended.
3. Add 1.5 l of lytic enzyme solution and invert tube 25 times to mix.

 

Which enzymes are likely to be present in this solution?

4. Incubate at 37 oC for 5 min to digest cell walls. Invert sample occasionally during the incubation.
5. Centrifuge for 1 min to pellet the cells. Pour of supernatant into discard pots. Pulse microcentrifuge tube and remove residual supernatant with a micropipette.
6. Add 300 l of cell lysis solution to the cell pellet and gently pipette up and down to lyse the cells. Heat sample at 80oC for 5 min to complete cell lysis.
7. Add 0.6 l of RNase A solution to the cell lysate, mix sample by inverting the tube 25 times and incubate at 37oC for 15 min.
8. Cool sample to room temperature by incubating on ice for 2 min
9. Add 100 l of protein precipitation solution to the cell lysate.
10. Vortex at high speed for 20 sec to mix the protein precipitation solution uniformly with the cell lysate and incubate on ice for 5 min.
11. Centrifuge for 3 min. The precipitated proteins should form a tight white pellet. If the protein pellet is not tight repeat previous step.
12. Pour off supernatant containing the genomic DNA (leaving behind the precipitated protein pellet) into the microcentrifuge tube containing the 300 l of isopropanol.
13. Mix the sample by inverting 50 times.
14. Centrifuge for 1 min and pour off supernatant into discard pot immediately.
15. Add 500 l of 70% ethanol to microcentrifuge tube. Inverting tube several times to dislodge the small white DNA pellet from the bottom of tube.
16. Centrifuge for 1 min and pour off supernatant into discard pot immediately.
17. Add 0.5 ml of 100% ethanol to microcentrifuge tube. Inverting tube several times to dislodge the small white DNA pellet from the bottom of tube.
18. Centrifuge for 1 min and pour off supernatant into discard pot immediately.
19. Pulse sample and leave to air dry.
20. Add 50 l of DNA hydration buffer to inner side of microcentrifuge tube, pulse and leave pellet to dissolve at 4oC overnight (this will be done for you)

 

Samples will then be frozen until next practical.

 

 

 

 

 

LAB PRACTICAL 2: Amplification of ORF HylP1 from N Ngenomic DNA using PCR

Safety

1) The thermocycler heating block gets hot. Don’t touch!

2) Microcentrifugesrotate at very high speeds. Always ensure that tubes are positioned in a balanced configuration and that all lids (inner covers are provided for some instruments) are tightly closed.

3) High voltage electricity is used for electrophoresis. Switch power packs on only after safety covers are in place. Do not touch leads, terminals or buffers while gels are running,

4) Ultraviolet (UV) light is a form of ionising radiation. Reduce skin exposure to a minimum and never look directly at the transilluminated without always protect your eyes with the UV filtering cover.

 

The following sequence (ORF HylP1, 1695 bp) will be amplified from N Ngenome using PCR (stop codon is underlined):

5’ATGAGCATTTATCATGCGCTGAAAGATTATCAGGAAGTGATTACCCGCGGCGATTATCTG

GTGTTTGATACCCCGCTGACCTGCCGCTTTATTGGCCGCTTTTTTCGCTTTGAAAACCAG

GAAGCGCTGAAAGCGGAACTGGCGACCAGCAAATATTTTCAGTGGATTGAAGAAGGCCAG

GCGGAACTGACCATGAAACATTTTTTTAACCGCCAGCTGGCGAAAGATGCGTTTACCCTG

AAAATTAGCGAAGATAAAGAAATTATTATTGAAAGCCAGAACCTGCGCGGCTTTCGCTAT

GCGCAGGAAGCGCTGCTGAAAGTGATGACCTTTAAAGGCGATAAACTGTATCTGCCGATT

GTGAGCGTGAAACATAGCCCGAGCTTTGCGATGCGCGGCATTATTGAAGGCTTTTATGGC

ACCCCGTGGACCCGCGAAGAACGCCTGGATTGCCTGCGCTTTATTGGCAACAAACGCATG

AACACCTATATGTATGCGCCGAAAGATGATGATTATCAGCGCAAACTGTGGCGCGATCTG

TATCCGGAAGATTGGGTGGCGTATTTTAAAGAACTGCTGGCGGTGGCGAAAGAAGAAGGC

CTGGATTTTTGGTATATGATTAGCCCGGGCCTGGATTTTGATTATACCAAAGAAGCGGAT

TATCAGCTGCTGTATCAGAAACTGCAGCAGCTGCTGGCGCTGGGCGTGTGCCATTTTGGC

CTGCTGCTGGATGATATTGATTATCAGATTGTGGATGCGGTGGAACGCCGCTTTAAAAAA

ACCGCGTATGCGCAGGCGCATCTGGCGACCCAGGTGCATGATTTTCTGAACCAGCAGCAT

GCGGCGCCGGAACTGGTGGTGTGCCCGACCGAATATGATAACCATCATGATAGCCTGTAT

CTGCAGGAACTGAGCGAACGCATTCCGAAAGAAATTGCGTTTTTTTGGACCGGCCCGAGC

ACCCTGGCGAGCCAGATTAGCCAGGCGGATATTGAAACCATGGCGGCGGTGTATCAGCGC

CCGATTATTATTTGGGATAACATTCCGGTGAACGATTATCAGAAAGATCCGGAACGCCTG

TTTCTGACCCCGTTTGCGAACCGCAGCCCGTTTCTGTGCCAGCCGGATTATCAGGTGAAA

GGCATTGTGAGCAACCCGATGATTAGCTGGGAACTGAGCAAACTGACCCTGACCGATATG

AGCCATTATCTGTGGGATGCGAACCGCTATCAGCCGAGCCATAGCTGGCTGGAAACCCTG

ACCGATTATACCGAAGATACCGAACTGGCGCTGGCGCTGCAGGCGTTTGCGTGGCATAAC

GGCAACCGCCATCTGCATCGCGAACTGCCGTTTGAAGTGGAAGAAGCGCTGCTGGCGAAA

GATGTGAGCACCCTGAGCGCGTGGGTGGCGGAACTGGTGGAACGCGTGAACACCCTGAAA

AAACTGGATAACCCGGCGTTTCAGCAGGCGATTGCGCCGTGGTTTGAACGCGTGGCGAAA

GATCAGGATTTTTGGCAGGCGATTCTGGAACAGGAACCGCAGCTGGAAACCCTGTATGCG

GATCTGCAGGAAGATAAACATCGCATTGGCAGCGATATTCCGAGCCGCTATTATCGCATT

CATTATCAGCAGCAGGATAAACTGACCGCGAACCAGGGCCAGGTGAGCCAGGCGCGCCCG

GAAGATTATGCGTGA3’ 6

 

*Due to specific binding of the antibody, PfxDNA polymerase is provided in an inactive form. Polymerase activity is therefore blocked at ambient temperatures, but is regained after the denaturation step in PCR cycling. This reagent provides an automatic “hot start” for PCR.

What is the purpose of a hot start?

Primer sequences

FP – 5’-CATATGAGCATTTATCATGCGCTGAAAGATTATC-3’ – NdeI restriction site in bold

RP – 5’-CTCGAGCGCATAATCTTCCGGGCG-3’ – XhoI restriction site in bold 7

 

Method:

Analysis of N N genomic DNA prepared last week

1. Dissolve the agarose in TAE buffer by boiling
2. Leave to cool on the bench for 2 min then ask the lecturer/demonstrator to add SYBR Safe DNA gel stain to the gel before pouring
3. Apply casting tray to the levelling table (will be demonstrated)
4. Pour gel solution into casting tray and leave to set (~ 15 min; don’t forget to locate the well-former first)
5. Place casting tray in electrophoresis tank and submerge gel in TAE buffer.
6. Add 6 l of N Ngenomic DNA to the 6 l loading buffer
7. Load 10 l of mixture from # 6 into a well
8. Also, load 5 l of DNA size standard on gel
9. Electrophorese at pre-set values of 200 V & 100 mA for 45 min.
10. Photograph the gel
11. Gel photo will be available on the eLearning Portal (Blackboard) this evening and discussed at the beginning of next week’s practical.

 

PCR amplification of ORF HylP1

The PCR reaction should be set up in a 200 l PCR tube and should contain the following concentrations of components in a total volume of 50 l:

0.3 M of forward primer (_1.5ul)

0.3 M of reverse primer (__1.5ul)

200 ng of N N genomic DNA (5ul)

1 x buffer (5ul)

0.3 mM of each dNTP (0.6ul)

1 mM of MgSO4 (1ul)

2.5 U of Pfx DNA polymerase (1ul)

water to 50 l (34.4ul)

 

Pipette volumes as demonstrated. Add the largest volume to PCR tube first and add the polymerase last. Label tubes with your initials. Pulse (centrifuge for 5 seconds) tubes, so that all the reaction mixture is at the bottom of the tube, prior to loading them in the thermocycler.

What is the purpose of the thermocycler’s heated lid?

The PCR will be performed at a primary annealing temperature (that determined from the Tm values calculated from the parts of the primers which anneal to the genomic DNA template) for 5 cycles and a secondary annealing temperature (that determined from the Tm values calculated from the entirety of the primers) for 20 cycles. Additionally, a touchdown step, of 14 cycles, will be incorporated prior to the final 20 cycles. The denaturation and elongation temperatures will be 94.0 & 68.0oC, respectively, but the annealing temperature will start 7oC higher than the 2o annealing temperature and will reduce by 0.5oC every cycle.

my result is the first line from left and you compare it to the last one from right the stander size 

LAB PRACTICAL 3: Cloning of PCR products into pET-22b

1) Microcentrifugesrotate at very high speeds. Always ensure that tubes are positioned in a balanced configuration and that all lids (inner covers are provided for some instruments) are tightly closed.

2) High voltage electricity is used for electrophoresis. Switch power packs on only after safety covers are in place. Do not touch leads, terminals or buffers while gels are running,

3) Ultraviolet (UV) light is a form of ionising radiation. Reduce skin exposure to a minimum and never look directly at the transilluminated without always protect your eyes with the UV filtering cover.

 

Method:

Analysis of PCR products by agarose gel electrophoresis

1. Dissolve the agarose in TAE buffer by boiling
2. Leave to cool on the bench for 2 min then ask the lecturer/demonstrator to add SYBR Safe DNA gel stain to the gel before pouring
3. Apply casting tray to the levelling table (will be demonstrated)
4. Pour gel solution into casting tray and leave to set (~ 15 min; don’t forget to locate the well-former first)
5. Place casting tray in electrophoresis tank and submerge gel in TAE buffer.
6. Add 6 l of N Ngenomic DNA to the 6 l loading buffer
7. Load 10 l of mixture from # 6 into a well
8. Also, load 5 ul of DNA size standard on gel
9. Electrophorese at pre-set values of 200 V & 100 mA for 45 min.
10. Photograph the gel
11. Gel photo will be available on the eLearning Portal (Blackboard) this evening and discussed at the beginning of next week’s practical.

 

Restriction digestions of the PCR product and pET-22b with Nde I and Xho I

1. Add the following amounts of components in a total volume of 10 l:

 

1 g of PCR product from last week (5ul)/pET-22b (1ul)

1 x digestion buffer (1ul)

10 U of NdeI(1ul)*

10 U of XhoI (1ul)*

water to 10 l (2ul) / pET-22(6ul)

* 10 U of enzyme are required to digest 1 g of DNA

Pipette volumes as demonstrated. Add the largest volume to the 1.5 ml microtube first and add the restriction enzymes last.

2. Incubate for 30 min. at 37 oC.

 

3. Incubate at 65 oC for 10 min.

 

What is the role of this incubation?

4. Chill on ice

my result is the first line from left  and you compare it to the last one from right the stander size 

Ligation of digested PCR products with digested pET-22b

1. Add the following to a 1.5 ml microtube:

 

100 ng of digested pET-22b (1ul)

3 x more fragments of digested PCR product (1ul)

1 x ligation buffer (1ul)

3 U of T4 DNA ligase (1ul)

water to 10 l (6ul)

Think about what appropriate controls you should set up

2. Incubate at 16oC overnight

 

3. Samples will be frozen until required next week

LAB PRACTICAL 4: Transformation of ligations Centrifuges rotate at very high speeds. Always ensure that tubes are positioned in a balanced configuration and that all lids (inner covers are provided for some instruments) are tightly closed.Methods:

N.B. Centrifugation was always performed at top speed (14000 x g).

Production of chemically competent XL1-Blue cells

1. Centrifuge 1 microtube of XL1-Blue cells for 1 min
2. Decant the spent medium, pulse for a few seconds, remove residual spent medium and resuspend each pellet in 0.9 ml of chilled MgCl2-CaCl2 solution by vortexing (Do not let cells warm up, returned to ice after 3 sec of vortexing. Ensure cells are completely resuspended)
3. Incubate on ice for 10 min
4. Centrifuge cells 1 min
5. Decant solution, pulse for a few seconds, remove residual solution and resuspend each pellet in 50 l of 0.1 M CaCl2 using a 200 l micropipette (Do not let cells warm up, returned to ice after 3 sec of pipetting up and down. Ensure cells are completely resuspended)

 

Transformation of competent cells with last week’s ligations

1. Add 5 l of the ligation from last week to the microtube containing the competent cells, mix by swirling with the pipette tip, don’t pipette up and down
2. Incubate microtube on ice for 20 min
3. Incubate microtube at 42oC for 90 sec
4. Return microtube to ice
5. Aseptically add 200 l of LB medium to the microtube and incubate in a water bath set at 37oC for 45 min.
6. Spread plate entire contents of the microtube onto 1 LB/Ap agar plate (this will be demonstrated)

 

Pouring LB agar plates

1. Pour plate as demonstrated
2. Leave to set for about 15 min
3. The plates will be incubated overnight at 37oC and then stored at 4oC until next week.

LAB PRACTICAL 5: Plasmid preparation and transformation

1) Centrifuges rotate at very high speeds. Always ensure that tubes are positioned in a balanced configuration and that all lids (inner covers are provided for some instruments) are tightly closed.

2) High voltage electricity is used for electrophoresis. Switch power packs on only after safety covers are in place. Do not touch leads, terminals or buffers while gels are running,

3) Ultraviolet (UV) light is a form of ionising radiation. Reduce skin exposure to a minimum and never look directly at the transilluminated without always protect your eyes with the UV filtering cover.

 

Methods:

Plasmid mini-preparation purification

N.B. Centrifugation was always performed at top speed (14000 x g).

1. Decant 1.5 ml of your 5 ml overnight culture into 1 fresh 1.5 ml microtube
2. Microcentrifuge the cells for 1 min
3. Decant the spent medium, pulse and remove residual supernatant
4. Resusupend pellet in 150 l of STET buffer and vortex until the cells are COMPLETELY resuspended
5. Add 10 l of 10 mg/ml lysozyme to lyse cells and mix cells by gentle inversion 5-6 times
6. Incubate at room temperature for 5 min
7. Boil samples for 40 sec and centrifuge for 15 min immediately after removal from boiling water bath
8. Remove pellet (please ask for this to be demonstrated to you) and keep the supernatant
9. To the remaining supernatant, add 150 l of chilled isopropanol and mix by gentle inversion 5-6 times
10. Incubate at – 85 oC for 15 min to allow DNA to precipitate
11. On removal from the freezer centrifuge immediately for 5 min.
12. Discard the supernatant, pulse and remove the residual supernatant
13. Add 500 l of absolute ethanol and centrifuge for 3 min
14. Discard the supernatant, pulse and remove the residual supernatant
15. Air dry samples for 10 min with lids open in 60 oC heat block to remove all traces of ethanol
16. Resuspend pellet in 20 l of TE buffer containing 100 g/ml RNase
17. Add 6 l of the plasmid preparation to the a 1.5 ml microtube containing 6 l of loading buffer
18. Load 10 l of the mixture from above onto an agarose gel
19. Also load 5 l of DNA size standard on gel
20. Electrophorese at pre-set values of 200 V & 100 mA
21. Photograph the gel
22. Gel photo will be available on the eLearning Portal (Blackboard) this evening and discussed at the beginning of next weeks practical.

 

Preparation of an agarose gel

1. Dissolve the agarose in TAE buffer by microwaving
2. Leave to cool on the bench for 2 min then ask the lecturer/demonstrator to add SYBR Safe DNA gel stain to the gel before pouring
3. Tap-up open ends of casting tray
4. Pour gel solution into casting tray and leave to set (~ 15 min; don’t forget to locate the well-former first)
5. Remove tape from casting tray, place in electrophoresis tank and submerge gel in TAE buffer.

 

my result is the first line from left  and you compare it to the last one from right the stander size ( its not clear in here but try to get it )

 

Pouring LB agar plates

1. Pour plate as demonstrated
2. Leave to set for about 15 min
3. The plates will be incubated overnight at 37oC and then stored at 4oC until next week

 

Transformation of BL21 competent cells with plasmid preparations

1. Add 5 l of your plasmid preparation to the BL21 competent cells microtubes (mix by swirling with the pipette tip, don’t pipette up and down)
2. Incubate tube on ice for 20 min
3. Incubate tube at 42 oC for 1 min
4. Return tube to ice
5. Spread plate entire contents of tube onto 1 LB/Ap agar plate (this will be demonstrated)
6. The plates will be incubated overnight at 37oC and then stored at 4oC until next week

LAB PRACTICA 6: Purification and characterisation of hyaluronidase HylP1

1) High voltage electricity is used for electrophoresis. Switch power packs on only after safety covers are in place. Do not touch leads, terminals or buffers while gels are running, One colony from a plate resulting from the transformation of E. coli BL21 with the recombinant pET-22b clone containing PCR product amplified with forward and reverse primers was inoculated into 10 ml of LB and grown at 37 oC, 200 rpm to an OD550 of 0.6, induced via the addition of IPTG to a concentration of 1 mM, then grown for 16 hr at 20oC, 100 rpm. These cells were pelleted, resuspended in 1 ml of Wash Buffer (see below), lysed via sonication for 1 min, centrifuged at 24 000 x g to remove cell debris and the supernatant (the cell free extract, CFE) removed and frozen until required. This CFE contains C-terminal-tagged HylP1. The C-terminal tag contains 6 histidine residues (underlined and embolden, see below) that facilitates purification via immobilised metal affinity chromatography (IMAC). Histidine residues present in the C-terminal hexahistidine tag of HylP1 form complexes with transition metal ions such as Ni2+. Thus by using spin columns packed with Ni Sepharose resin it is possible to purify recombinant HylP1 expressed by E. coli BL21. The other proteins expressed by E. coli BL21 will not bind to the resin and will therefore be separated from HylP1. Once all the other proteins have been washed off the column, HylP1 can then be competitively eluted from the column using 500 mM imidazole, which like histidine residues also has affinity for transition metals. The imidazole that is present in the eluant (spin-through) can then be removed from HylP1 using a Sephadex G-25 resin with an exclusion limit (Mr) of 5 × 103 globular protein.

Methods

Purification of HylP1 using IMAC

1. Unscrew the stoppers from the top and bottom of the HisTrapcolumn and screw the syringe connector into the top of the column.
2. Fill a 10 ml syringe with 5 ml of Elution buffer and insert syringe in the connector.
3. Apply the Elution buffer to the column and collect the eluant in the 100 ml beaker.
4. Remove the 10 ml syringe and fill it with 5 ml of 18.2 MΩ/cm water and insert syringe into the connector.
5. Apply the water to the column and collect the eluant in the 100 ml beaker.
6. Remove the 10 ml syringe and fill it with 5 ml of Stripping buffer and insert syringe in the connector.
7. Apply the stripping buffer to the column and collect the eluant in the 100 ml beaker.
8. Remove the 10 ml syringe and fill it with 5 ml of 18.2 MΩ/cm water and insert syringe into the connector.
9. Apply the water to the column and collect the eluant in the 100 ml beaker.
10. Remove the 10 ml syringe and fill it with 5 ml of Charging buffer and insert syringe into the connector.
11. Apply the Charging buffer to the column and collect the eluant in the 100 ml beaker.
12. Remove the 10 ml syringe and fill it with 5 ml of 18.2 MΩ/cm water and insert syringe into the connector.
13. Apply the water to the column and collect the eluant in the 100 ml beaker.
14. Remove 10 ml syringe and fill it with 5 ml of Binding buffer.
15. Apply the Binding buffer to the column and collect the eluant in the 100 ml beaker.
16. Remove 10 ml syringe and fill a 1 ml syringe with 1 ml of the CFE provided.
17. Apply the CFE to the column.
18. Remove 1 ml syringe and fill the 10 ml syringe with 5 ml of Washing buffer.
19. Apply the Washing buffer to the column and collect the eluant in the 100 ml beaker.
20. Remove the 10 ml syringe and fill a 5 ml syringe with 2 ml of Elution buffer.
21. Apply the Elution buffer to the column and collect eluant in a fresh empty universal

Desalting of HylP1

1. Unscrew the stoppers from the top and bottom of the HiTrapcolumn and screw the syringe connector into the top of the column.
2. Fill a 10 ml syringe with 10 ml Desalting buffer and insert syringe into the connector.
3. Apply the Desalting buffer to the column and collect eluant in the 100 ml beaker.
4. Repeat steps 2 and 3
5. Remove the 10 ml syringe and fill a 5 ml syringe with 1.5 ml of the eluant that contains your purified HylP1 protein that you kept from the HisTrap column.
6. Apply the purified HylP1 protein to the column and collect eluant in the 100 ml beaker.
7. Fill the 5 ml syringe with 2 ml of Desalting Buffer.
8. Apply the Desalting buffer to the column and collect eluant in a fresh empty universal.

Note. Elution from the final step should contain purified desalted (i.e. no imidazole) HylP1 protein.

Note. Unscrew the syringe connector from the top of the HiTrap column and screw the stoppers back on the top and bottom of the column.

Denaturing Polyacrylamide gel electrophoresis (PAGE) of purified desalted HylP1 to determine purity

1. Add 20 μl of your purified desalted HylP1 to 5 μl of loading buffer and boil for 3 min.
2. Load 20 μl of enzyme/loading buffer mix onto gel.
3. This gel will also contain high molecular weight (relative molecular weights: 205000, 116000, 97000, 84000, 66000, 45000, 36000) size standard and CFE.
4. Electrophorese for 50 min at 100 mA. The gel will be stained (in 0.5 g Coomassie Brilliant Blue, 225 ml methanol, 50 ml glacial acetic acid; per litre) for 10 min and the destain (in 100 ml methanol, 100 ml glacial acetic acid; per litre) overnight. A photograph of the gel will be posted on the eLearning Portal within 1 week.

the first line from the left is the size standard , the second line is the CFE my result is the first one from the right (please assume the gel do not contain a size standard )

 

 

 

 

Spectrophotometric assay of HylP1

1. Add the following together in a 1 ml plastic cuvette: 680 μl of pNP-NAG, 20 μl of HEPES, 100 μl of BSA.
2. Zero the spectrophotometer with the cuvette.
3. Then add 200 μl of purified desalted HylP1, mix well by pipetting up and down and monitor rate of reaction every 10 sec for 2 min at 410 nm.

Note. If your reaction is too slow then add a further 400 μl of purified desalted HylP1.

This is the data you need to determine the specific activity of the enzyme and discuss them is the discussion part , also the calculation , and the graph

Time	Absorbance
10s	0.312 nm
20s	0.401 nm
30s	0.482 nm
40s	0.561 nm
50s	0.643 nm
60s	0.701 nm
70s	0.778 nm
80s	0.838 nm
90s	0.887nm
100s	0.912nm
110s	0.951nm
120s	0.985 nm

Determination of enzyme concentration Add 1 ml of desalted purified enzyme to a 1 ml quartz cuvette and measure the absorbance at 280 nm.= 0.146 nmAppendix

Amino acid sequence of HylP1

MSIYHALKDYQEVITRGDYLVFDTPLTCRFIGRFFRFENQEALKAELATSKYFQWIEEGQAELTMKHFFNRQLAKDAFTLKISEDKEIIIESQNLRGFRYAQEALLKVMTFKGDKLYLPIVSVKHSPSFAMRGIIEGFYGTPWTREERLDCLRFIGNKRMNTYMYAPKDDDYQRKLWRDLYPEDWVAYFKELLAVAKEEGLDFWYMISPGLDFDYTKEADYQLLYQKLQQLLALGVCHFGLLLDDIDYQIVDAVERRFKKTAYAQAHLATQVHDFLNQQHAAPELVVCPTEYDNHHDSLYLQELSERIPKEIAFFWTGPSTLASQISQADIETMAAVYQRPIIIWDNIPVNDYQKDPERLFLTPFANRSPFLCQPDYQVKGIVSNPMISWELSKLTLTDMSHYLWDANRYQPSHSWLETLTDYTEDTELALALQAFAWHNGNRHLHRELPFEVEEALLAKDVSTLSAWVAELVERVNTLKKLDNPAFQQAIAPWFERVAKDQDFWQAILEQEPQLETLYADLQEDKHRIGSDIPSRYYRIHYQQQDKLTANQGQVSQARPEDYALEHHHHHH

Relative molecular mass of HylP1

67361.1

Amino acid composition of HylP1

Ala (A) 47 8.2%

Arg (R) 29 5.1%

Asn (N) 17 3.0%

Asp (D) 41 7.2%

Cys (C) 5 0.9%

Gln (Q) 39 6.8%

Glu (E) 44 7.7%

Gly (G) 18 3.1%

His (H) 22 3.8%

Ile (I) 30 5.2%

Leu (L) 63 11.0%

Lys (K) 30 5.2%

Met (M) 10 1.7%

Phe (F) 30 5.2%

Pro (P) 25 4.4%

Ser (S) 25 4.4%

Thr (T) 28 4.9%

Trp (W) 14 2.4%

Tyr (Y) 31 5.4%

Val (V) 24 4.2%

Total 572

Beer-Lambert’s law

A = cl

(where A = absorbance;  = molar absorptivity coefficient; l = path length of cuvette)

The molar absorptivity coefficient () of HylP1 at 280 nm can be calculated from the following equation

 (mol-1 L cm-1) = (#Trp x 5500) + (#Tyr x 1490) + (#Cys x 125)

(Gill and von Hippel, 1989 & Pace et al., 1995).

The molar absorptivity co-efficient () of p-nitrophenol at 410 nm

18 300 mol-1 L cm-1 22

 

Important notes for the calculation :

1)You have to draw graph for the enzymes activity .

2) in the calculation for the beer-lambert’s you must use all the unites

{ (umole/min/umole) then to (umole/min/mg) then to ( kata/kg) }

Its very important  if you need a help with the calculation let me know and I will send you youtube link will help you to answer this part very well..